A8GK78 (FIS_SERP5) Serratia proteamaculans (strain 568)

DNA-binding protein Fis UniProtKBInterProSTRINGInteractive Modelling

98 aa; Sequence (Fasta) 702 identical sequences

Sequence Features

 74-93H-T-H motif.
 55-95DNA binding HTH domain, Fis-type

Sequence Alignments

Experimental structures

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) Heteromer
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) Heteromer
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) Heteromer
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT) Heteromer
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) Heteromer
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21 Heteromer
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) Heteromer
Crystal structure of Fis bound to 27 bp optimal binding sequence F1 Heteromer
Crystal structure of Fis bound to 27 bp optimal binding sequence F2 Heteromer
Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at center Heteromer
Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at center Heteromer
Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at center Heteromer
Crystal structure of Fis bound to 27bp non consensus sequence DNA F6 Heteromer
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23 Heteromer
Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at center Heteromer
Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;
Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;