SMTL ID : 5ds9.1

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Coordinates
PDB Format
Method
X-RAY DIFFRACTION 2.56 Å
Oligo State
homo-dimer
Ligands
None
Links
RCSB   PDBe   PDBj   PDBsum   CATH   PLIP
Citation
Hancock, S.P. et al., DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One (2016)
Release Date
2016-07-27
Peptides
DNA-binding protein Fis: AB
SMTL:PDB
SMTL Chain Id:
PDB Chain Id:
A
A
B
B

DNA-binding protein Fis

Related Entries With Identical Sequence

1ety.1 | 1fia.1 | 3fis.1 | 3iv5.1 | 3jr9.1 | 3jra.1 | 3jrb.1 | 3jrc.1 | 3jrd.1 | 3jre.1 | 3jrf.1 | 3jrg.1 | 3jrh.1 | 3jri.1 | 4ihv.1 | 4ihw.1 | 4ihx.1 | 4ihy.1 | 5dtd.1 | 5e3l.1 | 5e3m.1 | 5e3n.1 | 5e3o.1 | 6p0s.1 | 6p0t.1 | 6p0u.1