A1AGG1 (FIS_ECOK1) Escherichia coli O1:K1 / APEC

DNA-binding protein Fis UniProtKBInterProInteractive Modelling

98 aa; Sequence (Fasta) ; 613 identical sequences

Available Structures

32 Experimental Structures

DescriptionPDB IDOligo-stateRangeSeq id (%)Ligands
Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
8-98
100.0
Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
8-98
100.0
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
8-98
100.0
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71Lhomo-2-mer1-98
98.85
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp optimal binding sequence F1homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp optimal binding sequence F2homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp DNA F27 containing a C/G at centerhomo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at centerhomo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at centerhomo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at centerhomo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F18homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23homo-2-mer1-98
100
Crystal structure of Fis bound to 27bp non consensus sequence DNA F6homo-2-mer1-98
100
Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at centerhomo-2-mer1-98
100
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q74Ahomo-2-mer5-98
98.65
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72Ahomo-2-mer5-98
98.67
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72Dhomo-2-mer5-98
98.7
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q68Ahomo-2-mer5-98
98.67
THE CRYSTAL STRUCTURE OF E. COLI WILD-TYPE FIShomo-2-mer6-98
100.0
CRYSTAL STRUCTURE OF THE FACTOR FOR INVERSION STIMULATION FIS AT 2.0 ANGSTROMS RESOLUTIONhomo-2-mer10-98
100.0
THE CRYSTAL STRUCTURE OF FIS MUTANT K36E REVEALS THAT THE TRANSACTIVATION REGION OF THE FIS PROTEIN…homo-2-mer10-98
98.88
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71Yhomo-2-mer10-98
98.82
THE STRUCTURE OF FIS MUTANT PRO61ALA ILLUSTRATES THAT THE KINK WITHIN THE LONG ALPHA-HELIX IS NOT D…homo-2-mer26-98
98.63
THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHAN…homo-2-mer26-98
100
THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHAN…homo-2-mer26-98
98.63

1 SWISS-MODEL model

TemplateOligo-stateQMEANDisCoRangeLigandsTrg-Tpl Seq id (%)
3jr9.1.Ahomo-2-mer0.771-98
100.00