A7ZSF6 (FIS_ECO24) Escherichia coli O139:H28 (strain E24377A / ETEC)

DNA-binding protein Fis UniProtKBInterProInteractive Modelling

98 aa; Sequence (Fasta) 692 identical sequences

Sequence Features

 74-93H-T-H motif.
 55-95DNA binding HTH domain, Fis-type
IPR002197PF02954

Sequence Alignments

Experimental structures

DescriptionOligo-stateLigandsStructureRangeDownloadAssess
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71L Heteromer
P0A6R3;
1eto1-98
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) Heteromer
P0A6R3;
5ds91-98
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) Heteromer
P0A6R3;
5dtd1-98
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) Heteromer
P0A6R3;
5e3l1-98
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT) Heteromer
P0A6R3;
5e3n1-98
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) Heteromer
P0A6R3;
5e3o1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21 Heteromer
P0A6R3;
3jrh1-98
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) Heteromer
P0A6R3;
5e3m1-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F1 Heteromer
P0A6R3;
3iv51-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F2 Heteromer
P0A6R3;
3jr91-98
Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at center Heteromer
P0A6R3;
3jrc1-98
Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at center Heteromer
P0A6R3;
3jrb1-98
Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at center Heteromer
P0A6R3;
3jrd1-98
Crystal structure of Fis bound to 27bp non consensus sequence DNA F6 Heteromer
P0A6R3;
3jra1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23 Heteromer
P0A6R3;
3jri1-98
Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at center Heteromer
P0A6R3;
3jre1-98
Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;
6p0s8-98
Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;
6p0u8-98
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis Heteromer
P0A6R3; P03699;
6p0t8-98
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q74Ahomo-2-mer 1etx5-98
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72Ahomo-2-mer 1etv5-98
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72Dhomo-2-mer 1etw5-98
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q68Ahomo-2-mer 1etk5-98
THE CRYSTAL STRUCTURE OF E. COLI WILD-TYPE FIShomo-2-mer 1ety6-98
CRYSTAL STRUCTURE OF THE FACTOR FOR INVERSION STIMULATION FIS AT 2.0 ANGSTROMS RESOLUTIONhomo-2-mer 1fia10-98
THE CRYSTAL STRUCTURE OF FIS MUTANT K36E REVEALS THAT THE TRANSACTIVATION REGION OF THE FIS PROTE...homo-2-mer 1f3610-98
THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71Yhomo-2-mer 1etq10-98
THE STRUCTURE OF FIS MUTANT PRO61ALA ILLUSTRATES THAT THE KINK WITHIN THE LONG ALPHA-HELIX IS NOT...homo-2-mer 1fip26-98
THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CH...homo-2-mer 4fis26-98
THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CH...homo-2-mer 3fis26-98