C5BEX0 (FIS_EDWI9) Edwardsiella ictaluri (strain 93-146)

DNA-binding protein Fis UniProtKBInterProInteractive Modelling

98 aa; Sequence (Fasta) ; 805 identical sequences

Available Structures

32 Experimental Structures

DescriptionPDB IDOligo-stateRangeLigands
Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21homo-2-mer1-98
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)homo-2-mer1-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F1homo-2-mer1-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F2homo-2-mer1-98
Crystal structure of Fis bound to 27 bp DNA F27 containing a C/G at centerhomo-2-mer1-98
Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at centerhomo-2-mer1-98
Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at centerhomo-2-mer1-98
Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at centerhomo-2-mer1-98
Crystal structure of Fis bound to 27bp non consensus sequence DNA F6homo-2-mer1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23homo-2-mer1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F18homo-2-mer1-98
Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at centerhomo-2-mer1-98


TemplateOligo-stateQMEANDisCoRangeLigandsTrg-Tpl Seq id (%)