Q5PJW3 (FIS_SALPA) Salmonella paratyphi A (strain ATCC 9150 / SARB42)

DNA-binding protein Fis UniProtKBInterProInteractive Modelling

98 aa; Sequence (Fasta) 841 identical sequences

Sequence Features

 74-93H-T-H motif
 55-95DNA binding HTH domain, Fis-type

Sequence Alignments

Experimental structures

Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis Heteromer
P03699; P0A6R3;
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)homo-2-mer 5ds91-98
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)homo-2-mer 5dtd1-98
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)homo-2-mer 5e3n1-98
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)homo-2-mer 5e3l1-98
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)homo-2-mer 5e3o1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21homo-2-mer 3jrh1-98
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)homo-2-mer 5e3m1-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F2homo-2-mer 3jr91-98
Crystal structure of Fis bound to 27 bp optimal binding sequence F1homo-2-mer 3iv51-98
Crystal structure of Fis bound to 27 bp DNA F29 containing 5 G/Cs at centerhomo-2-mer 3jrc1-98
Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at centerhomo-2-mer 3jrd1-98
Crystal structure of Fis bound to 27 bp DNA F24 containing T-tract at centerhomo-2-mer 3jrb1-98
Crystal structure of Fis bound to 27 bp non consensus sequence DNA F23homo-2-mer 3jri1-98
Crystal structure of Fis bound to 27bp non consensus sequence DNA F6homo-2-mer 3jra1-98
Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at centerhomo-2-mer 3jre1-98